View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_76 (Length: 248)
Name: NF2848_low_76
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_76 |
 | |
|
| [»] scaffold0014 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 108 - 231
Target Start/End: Complemental strand, 83801 - 83678
Alignment:
| Q |
108 |
attagtcatgggttcaactttggccaacaaattattcctatcaattttcttcaatcaagtatcatcatataattgtatggaatgctgaacagtttaactt |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
83801 |
attagtcatgggttcaactttggcgaacaaattatgcctgtcaattttcttcaatcaagtatcatcatataattgtatggaatcctgaacagtttaactt |
83702 |
T |
|
| Q |
208 |
taaactattcaaacttattgaaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
83701 |
taaactattcaaacttattgaaaa |
83678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 12 - 95
Target Start/End: Complemental strand, 83941 - 83858
Alignment:
| Q |
12 |
agcaaaggcaaagaactaagatacttataataaattcattctcatgaccacactatcaaacaaactttaaataatttatgataa |
95 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83941 |
agcaaaggtaaagaactaaaatacttataataaattcattctcatgaccacactatcaaacaaactttaaataatttatgataa |
83858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University