View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_79 (Length: 239)
Name: NF2848_low_79
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 40719044 - 40718840
Alignment:
| Q |
18 |
aaattatgccattgttttcaaatatataaattatttttacaagaaacagatggaacatatcaaccacgcacccgccaatttattttcatttttgagaaaa |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40719044 |
aaattatgctattgttttcaaatatataaattatttttacaagaaacagatggaacatatcaaccacgcacccgccaatttattttcatttttgagaaaa |
40718945 |
T |
 |
| Q |
118 |
cccgccaatttaatttatttgttcggcgccataggttcaaatatatgcattttcaaacttttttgtgtcccttggaacaattggttaagtttggtctgaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718944 |
cccgccaatttaatttatttgttcggcgccataggttcaaatatatgcattttcaaactttttagtgtcccttggaacaattggttaagtttggtctgaa |
40718845 |
T |
 |
| Q |
218 |
atatt |
222 |
Q |
| |
|
||||| |
|
|
| T |
40718844 |
atatt |
40718840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University