View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_89 (Length: 234)
Name: NF2848_low_89
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 9869031 - 9869198
Alignment:
| Q |
1 |
tacaataattgtttgatttaccttctattatggttttacttcnnnnnnnncttactcaactttatagtgttactaattaagattcatgttttacaaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9869031 |
tacaataattgtttgatttaccttctattatggttttactttttttttttcttactcaactttatagtgttactaa----gattcatgttttacaaatat |
9869126 |
T |
|
| Q |
101 |
aattgtcttgtcccatgttatatatacatgtttgtcttccattatctccatgacttctacttttctcctttc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9869127 |
aattgtcttgtcccatgttatatatacatgtttgtcttccattatctccatgacttctacttttctcctttc |
9869198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University