View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_95 (Length: 220)
Name: NF2848_low_95
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_95 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 39927524 - 39927593
Alignment:
| Q |
16 |
aaatcaaatatatggtgattggtataaaattttgttggttgctaagatgttagtgacaaaatttacatgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
39927524 |
aaatcaaatatatggtgattggtataaaattttgttggttgctaagatgttggtgacaaaatttatatgt |
39927593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 39927585 - 39927654
Alignment:
| Q |
130 |
tttacatgtactcatatcatt-gtcaaaaccatggaagaataatttttgagatatgctaacttgtatcct |
198 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||||| |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
39927585 |
tttatatgtactcgtatcatttgtcaaaaccatcgaagaataatttttgagaaatgctaacttgtgtcct |
39927654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University