View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2851_high_11 (Length: 415)
Name: NF2851_high_11
Description: NF2851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2851_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 18 - 415
Target Start/End: Original strand, 52544087 - 52544480
Alignment:
| Q |
18 |
gatgtcagattagtcatttgatggatcgttcatcaatgcactttactagatgtcccgtttataggattgttgataaatgctttgtgtctatcatacagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544087 |
gatgtcagattagtcatttgatggatcgttcatcaatgcactttactagatgtccc----ataggattgttgataaatgctttgtgtctatcatacagtt |
52544182 |
T |
 |
| Q |
118 |
tgtgtataaattcagttggctctgattgtttatggtggtcttgacgcaattgattgcttgtagaaatacttcatcatcagttttttattttaatgctagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52544183 |
tgtgtataaattcagttggctctgattgtttatggtggtcttgactcaattgattgcttgtagaaatacttcatcatcagtttttgattttaatgctagc |
52544282 |
T |
 |
| Q |
218 |
cttttatgctgaactaagcctatcgtgcatggtacatggttggatgttcctgacttttcttgcctttgaatatgttctgttatggcttgaaatattgatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544283 |
cttttatgctgaactaagcctatcgtgcatggtacatggttggatgttcctgacttttcttgcctttgaatatgttctgttatggcttgaaatattgatt |
52544382 |
T |
 |
| Q |
318 |
cttcttgaattgtgtgcttgtgcaaaacttttaaattgtgtgtttgtgcaatgtgcatgcttcttttgtttttaaagaaataattttgttcaagaatt |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
52544383 |
cttcttgaattgtgtgcttgtgcaaaacttttaaattgtgtgtttgtgcaatgtgcatgcttcttttgttttcaaagaaataattttgtccaagaatt |
52544480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University