View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2851_low_23 (Length: 252)

Name: NF2851_low_23
Description: NF2851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2851_low_23
NF2851_low_23
[»] chr3 (2 HSPs)
chr3 (99-252)||(44649074-44649227)
chr3 (1-33)||(44648977-44649009)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 99 - 252
Target Start/End: Original strand, 44649074 - 44649227
Alignment:
99 atcacatgtcccttatgttcccttggtatgtcccccaatccaggaccaaggatcccttcctaagtcccaaaaaatagtgatcgtagcttaatttctggat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44649074 atcacatgtcccttatgttcccttggtatgtcccccaatccaggaccaaggatcccttcctaagtcccaaaaaatagtgatcgtagcttaatttctggat 44649173  T
199 tttggagggggctgtgagcaattagggtcttttgagcaaatatcgatgagatta 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44649174 tttggagggggctgtgagcaattagggtcttttgagcaaatatcgatgagatta 44649227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 44648977 - 44649009
Alignment:
1 aaagttgctcaaaagccccttaaattgcttaca 33  Q
    ||||||||| |||||||||||||||||||||||    
44648977 aaagttgctaaaaagccccttaaattgcttaca 44649009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University