View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2851_low_23 (Length: 252)
Name: NF2851_low_23
Description: NF2851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2851_low_23 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 99 - 252
Target Start/End: Original strand, 44649074 - 44649227
Alignment:
| Q |
99 |
atcacatgtcccttatgttcccttggtatgtcccccaatccaggaccaaggatcccttcctaagtcccaaaaaatagtgatcgtagcttaatttctggat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44649074 |
atcacatgtcccttatgttcccttggtatgtcccccaatccaggaccaaggatcccttcctaagtcccaaaaaatagtgatcgtagcttaatttctggat |
44649173 |
T |
|
| Q |
199 |
tttggagggggctgtgagcaattagggtcttttgagcaaatatcgatgagatta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44649174 |
tttggagggggctgtgagcaattagggtcttttgagcaaatatcgatgagatta |
44649227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 44648977 - 44649009
Alignment:
| Q |
1 |
aaagttgctcaaaagccccttaaattgcttaca |
33 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
44648977 |
aaagttgctaaaaagccccttaaattgcttaca |
44649009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University