View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2852_high_15 (Length: 294)
Name: NF2852_high_15
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2852_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 10794360 - 10794592
Alignment:
| Q |
1 |
acttttagattacaaatattaactgagataaatc-------ttacagtagggagccccaataagtattagcagttctaacaataaagtatgctccagtta |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794360 |
acttttaggttacaaatattaactgagataaatcaataatcttacagtagggagccccaataagtattagcagttctaacaataaagtatgctccagtta |
10794459 |
T |
 |
| Q |
94 |
gtataagtttgttttggcgtagcaatggttccagaatccgttgctcaataattcctgctagtacttgatacctgatcacataaacaaatccacaataatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794460 |
gtataagtttgttttggcgtagcaatggttccagaatccgttgctcaataattcctgctagtacttgatacctgatcacataaacaaatccacaataatt |
10794559 |
T |
 |
| Q |
194 |
tgaggatataaattactgaacttaaacttatgt |
226 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
10794560 |
tgaggatataaattactgaacttaaacatatgt |
10794592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 231 - 277
Target Start/End: Original strand, 10794703 - 10794749
Alignment:
| Q |
231 |
gaatatttgattgattactaactgtctgaaattatgtagtagtttgt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
10794703 |
gaatatttgattgattactaactgtctggaattctgtagtagtttgt |
10794749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University