View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2852_high_21 (Length: 249)
Name: NF2852_high_21
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2852_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 43985362 - 43985121
Alignment:
| Q |
1 |
tgcaacaaggaagagcttgttactgaaactttggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985362 |
tgcaacaaggaagagcttgttactgaaactctggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgc |
43985263 |
T |
|
| Q |
101 |
cgttgattgctgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgtggatgt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43985262 |
cgttgattactgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgttgatgt |
43985163 |
T |
|
| Q |
201 |
tgctggtgttcttgctaaggatgttacacttatgcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985162 |
tgctggtgttcttgctaaggatgttacacttatgcctttgct |
43985121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University