View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2852_high_23 (Length: 238)
Name: NF2852_high_23
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2852_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 36 - 222
Target Start/End: Original strand, 40519460 - 40519653
Alignment:
| Q |
36 |
aaatgaaaattgtcaagattataatagtgtttatgattgttgggggtggccctgcttcttcttcgcgttgctttatgggtttgtacagtgtttagggttt |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40519460 |
aaatgaaaattgtcaagattataatagggtttatgattgtcggggatggccctgcttcttcttcgcgttgctttatggttttgtacagtgtttagggttt |
40519559 |
T |
 |
| Q |
136 |
tctatgtagattaagtttacggnnnnnnnnntgttcata--------tgacgcgttttagaatatgatgattaacctgggtgaaaataacctatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519560 |
tctatgtagattaagtttacggaaaaaaaaatgttcatatttagtgttgacgcg-tttagaatatgatgattaacctgggtgaaaataacctatg |
40519653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University