View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2852_high_23 (Length: 238)

Name: NF2852_high_23
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2852_high_23
NF2852_high_23
[»] chr7 (1 HSPs)
chr7 (36-222)||(40519460-40519653)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 36 - 222
Target Start/End: Original strand, 40519460 - 40519653
Alignment:
36 aaatgaaaattgtcaagattataatagtgtttatgattgttgggggtggccctgcttcttcttcgcgttgctttatgggtttgtacagtgtttagggttt 135  Q
    ||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||    
40519460 aaatgaaaattgtcaagattataatagggtttatgattgtcggggatggccctgcttcttcttcgcgttgctttatggttttgtacagtgtttagggttt 40519559  T
136 tctatgtagattaagtttacggnnnnnnnnntgttcata--------tgacgcgttttagaatatgatgattaacctgggtgaaaataacctatg 222  Q
    ||||||||||||||||||||||         ||||||||        ||||||| ||||||||||||||||||||||||||||||||||||||||    
40519560 tctatgtagattaagtttacggaaaaaaaaatgttcatatttagtgttgacgcg-tttagaatatgatgattaacctgggtgaaaataacctatg 40519653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University