View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2852_low_19 (Length: 267)
Name: NF2852_low_19
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2852_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 37833765 - 37834012
Alignment:
| Q |
1 |
tcagttctaactgaggcatcaaactcatttgatttgaggttttgaaagtaatttagtggagggatgtggtcagattcaatgaggaaaagtgaagaaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37833765 |
tcagttctaactgaggcatcaaactcatttgatttgaggttttgaaagtaatttagtggagggatgtggtcagattcaatgaggaaaagtgaagaaacat |
37833864 |
T |
 |
| Q |
101 |
cttgagaattaggaaggtcatggaaatattcaagagggttttcaaggtcaaactccatggatgtgtggagaagaagatgttagtgaagttgagaagtaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
37833865 |
cttgagaattaggaaggtcatggaaatattcaagagggttttcaaggtcaaactccatggatgtgtgg---agaagatgttagtgatgttgagaagtaag |
37833961 |
T |
 |
| Q |
201 |
gaagatgataagcattgttatagggagagaaaagagaagtgataaagaaaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37833962 |
gaagatgataagcattgttatagggagagaaaagagaagtgataaagaaaa |
37834012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University