View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2852_low_20 (Length: 265)
Name: NF2852_low_20
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2852_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 51 - 141
Target Start/End: Complemental strand, 26914137 - 26914047
Alignment:
| Q |
51 |
ttcgacatatggttacactgcttattgtatatgggagagaatgaagttcttgtgatgtcattctttctagcatatcaaacaaattactcat |
141 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914137 |
ttcgaaatatggttacattgcttattgtatatgggagagaatgaagttcttgtgatgtcattctttctagcatatcaaacaaattactcat |
26914047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 140 - 249
Target Start/End: Complemental strand, 26913883 - 26913774
Alignment:
| Q |
140 |
atatatataccacataaaactcatacacaaccgtgataatcggcattcgaactccagtcatgattttcaacctaataagtttgtcggtttagctagactt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
26913883 |
atatatataccacataaaactcatacacaaccgtgataaccggcattcgaactccaatcataattttcaacctaacaagtttttcggtttagctgcactt |
26913784 |
T |
|
| Q |
240 |
tacggatatg |
249 |
Q |
| |
|
|||||||||| |
|
|
| T |
26913783 |
tacggatatg |
26913774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 142 - 246
Target Start/End: Complemental strand, 51181806 - 51181702
Alignment:
| Q |
142 |
atatataccacataaaactcatacacaaccgtgataatcggcattcgaactccagtcatgattttcaacctaataagtttgtcggtttagctagacttta |
241 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |||||| ||||||||| |||||| |
|
|
| T |
51181806 |
atatatgccacataaaattcacacacaaccgtgataaccggcattcgaactcctgtcatgatttcaaacctaataaatttgtcagtttagctaaacttta |
51181707 |
T |
|
| Q |
242 |
cggat |
246 |
Q |
| |
|
||||| |
|
|
| T |
51181706 |
cggat |
51181702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 64 - 129
Target Start/End: Complemental strand, 51181925 - 51181859
Alignment:
| Q |
64 |
tacactgcttattgtatatg-ggagagaatgaagttcttgtgatgtcattctttctagcatatcaaa |
129 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
51181925 |
tacattgcttattgtatatttggagagaatgaagttcttgtgatttcattcttgctaacatatcaaa |
51181859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University