View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2852_low_24 (Length: 249)

Name: NF2852_low_24
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2852_low_24
NF2852_low_24
[»] chr4 (1 HSPs)
chr4 (1-242)||(43985121-43985362)


Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 43985362 - 43985121
Alignment:
1 tgcaacaaggaagagcttgttactgaaactttggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgc 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43985362 tgcaacaaggaagagcttgttactgaaactctggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgc 43985263  T
101 cgttgattgctgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgtggatgt 200  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
43985262 cgttgattactgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgttgatgt 43985163  T
201 tgctggtgttcttgctaaggatgttacacttatgcctttgct 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43985162 tgctggtgttcttgctaaggatgttacacttatgcctttgct 43985121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University