View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2852_low_28 (Length: 233)

Name: NF2852_low_28
Description: NF2852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2852_low_28
NF2852_low_28
[»] chr7 (1 HSPs)
chr7 (140-217)||(28502104-28502181)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 140 - 217
Target Start/End: Original strand, 28502104 - 28502181
Alignment:
140 cttcaaaagaaatgatattttaatatcaaaatcaaacaatannnnnnnncatcaaacactatacaataactttatatt 217  Q
    |||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
28502104 cttcaaaagaaatgatattttaatatcaaaatcaaacaatattttttttcatcaaacactatacaataactttatatt 28502181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University