View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853R-Insertion-15 (Length: 268)
Name: NF2853R-Insertion-15
Description: NF2853R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853R-Insertion-15 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 268
Target Start/End: Complemental strand, 32376313 - 32376054
Alignment:
| Q |
9 |
gttatggcgttcgtgccgcgattgatatatttcattttctctgttctttgttgaatgttgtttctgtagttgaggcagatggatcaactactcatacagc |
108 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376313 |
gttatggtgttcgtgccgcaattgatatatttcattttctgtgttctttgttgaatgttgtttctgtagttgaggcagatggatcaactactcatacagc |
32376214 |
T |
 |
| Q |
109 |
tgatgaagatgttcagatttttgctttggttttgattaactcagctattgaattgagtggtgataagatagggaatcaccctaaacttttgaggatggtc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376213 |
tgatgaagatgttcagatttttgctttggttttgattaactcagctattgaattgagtggtgataagatagggaatcaccctaaacttttgaggatggtc |
32376114 |
T |
 |
| Q |
209 |
caagatgatttgtttcatcatttgatttactatggaacttggtctagttcatttgtcttg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376113 |
caagatgatttgtttcatcatttgatttactatggaacttggtctagttcatttgtcttg |
32376054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University