View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853R-Insertion-18 (Length: 195)
Name: NF2853R-Insertion-18
Description: NF2853R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853R-Insertion-18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 1083640 - 1083521
Alignment:
| Q |
8 |
acctgttttgctctttttgattgtgcttggctctctctcagacaaactactcctgcttctgtattccaagccacctcctgataaaggagacatgtttcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1083640 |
acctgttttgctctttttgattgtgcttggctctctctcagacaaactactcctgcttctgtattccaagccacctcctgataaaggaaacatgtttcaa |
1083541 |
T |
|
| Q |
108 |
ttcatcagattaaaattcac |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1083540 |
ttcatcagattaaaattcac |
1083521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 1083500 - 1083462
Alignment:
| Q |
157 |
ttatacacaacacaacccttttgcatttgcatcttggtt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1083500 |
ttatacacaacacaacccttttgcatttgcatcttggtt |
1083462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 6 - 66
Target Start/End: Complemental strand, 46763256 - 46763196
Alignment:
| Q |
6 |
tcacctgttttgctctttttgattgtgcttggctctctctcagacaaactactcctgcttc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||| || ||| |||| |||| |
|
|
| T |
46763256 |
tcacctgttttgctctttttgattgtgcatggttctctctcagagaagctattcctacttc |
46763196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University