View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_1D_high_20 (Length: 221)
Name: NF2853_1D_high_20
Description: NF2853_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_1D_high_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 45 - 221
Target Start/End: Original strand, 30504271 - 30504449
Alignment:
| Q |
45 |
gaaattgtacacttatttccttatcaaagaacaagagatgttccaggtttcaggattcaatctctacttctaaatatttctcttccaccaaaacttgttt |
144 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30504271 |
gaaattctacacttatttccttatcaaagaacaagagatgttccaggtttcaggattcaatctctacttctaaatatttctcttccaccaaaacttgtta |
30504370 |
T |
 |
| Q |
145 |
ataaaaaataaagactgaattagaaactca-ttcata-nnnnnnngttggcatgtaccggagaaattcaagaacatgag |
221 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30504371 |
ataaaaaataaagattgaattagagactcatttcatattttttttgttggtatgtaccggagaaattcaagcacatgag |
30504449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University