View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_1D_low_11 (Length: 341)
Name: NF2853_1D_low_11
Description: NF2853_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_1D_low_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 23 - 341
Target Start/End: Original strand, 139638 - 139955
Alignment:
| Q |
23 |
cccactgtctagtatcctagctatcaaggatctgatgtgtgtgtatggtggttttgcaatgtgatttcccacctttttgtcgtgatttctacatgtgcct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
139638 |
cccactgtctagtatcctagctatcaaggatctgatgtgtgtgtatggtggttttgcaatgtgatttcccacctttttgtcgtgatttctacatgtgcct |
139737 |
T |
 |
| Q |
123 |
catcttaaactcacctcagagattctccttcaggtttgatcccagaccatgcaagctctgcatatgatcaatcaagagtgtatgcatatgtctttaaatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
139738 |
catcttaaactcacctcagagattctccttcaggtttgatcccagaccatgcaagctctgcatatgatcaatcaagagtgtatgcatatgtctttaaatg |
139837 |
T |
 |
| Q |
223 |
ggtgtttatcacggtgatggacgtaaggcgtgaagaaagcatctataggcagcaacggatcaagatgatattatatacaacgcttttgtctgacaagatg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
139838 |
ggtgtttatcacggtgatggacgtaaggcgtgaagaaagcatctataggcagcaacggatcaagatgatattatatac-acgcttttgtctgacaagatg |
139936 |
T |
 |
| Q |
323 |
gtgggttctaacaagaaaa |
341 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
139937 |
gtgggttctaacaagaaaa |
139955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University