View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_1D_low_13 (Length: 324)
Name: NF2853_1D_low_13
Description: NF2853_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_1D_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 3 - 324
Target Start/End: Complemental strand, 54544522 - 54544199
Alignment:
| Q |
3 |
attgatgcttttgttttctggtttctacccatcataacagggtgaatattgatgtgtgtaagacggtacatactagccgagtaatatctgatgcttcatt |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54544522 |
attgatgctattgttttctggtttctacccatcataacagggtgaatattgatgtgtgtaagacggtacatactagccgagtaatatctgatgcttcatt |
54544423 |
T |
|
| Q |
103 |
ttttactcatcataattgtctgaatgtaacctatgtgtttgagagttggtaatgcagtagcgnnnnnnnnn--gttgccaaaatttagtggatctctcca |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54544422 |
ttttactcatcataattgtgtgaatgtaactcatgtgtttgagagttggtaatgcagtagacattttttttttgttgccaaaatttagtggatctctcca |
54544323 |
T |
|
| Q |
201 |
ctgtgtacggttgatgaaggtgatgcctatgagcttctacatgctttaaaatgagttcatgatcttcaattgaaacgaggatacactcttttcatttgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54544322 |
ctgtgtacggttgatgaaggtgatgcctatgagcttctacttgctttaaaatgagttcatgatcttcaattgaaacgaggatacactcttttcatttgaa |
54544223 |
T |
|
| Q |
301 |
ttttttcttccatttttatctttg |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
54544222 |
ttttttcttccatttttatctttg |
54544199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University