View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_1D_low_17 (Length: 298)
Name: NF2853_1D_low_17
Description: NF2853_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_1D_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 40382996 - 40382699
Alignment:
| Q |
1 |
actttttcaccattttagcttccttctgggctgggagctccttcgtcacgttcctctccggcgttgtttcgcatgtgatgcttggtttcaccgttgtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382996 |
actttttcaccattttagcttccttctgggctgggagctccttcgtcacgttcctctccggcgttgtttcgcatgtgatgcttggtttcaccgttgtggt |
40382897 |
T |
 |
| Q |
101 |
tgctattttagcttactttcttctcttcagtggattcttcatcagtagggataggattccaccttactggatatggttccattacctatcactggtgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382896 |
tgctattttagcttactttcttctcttcagtggattcttcataagtagggataggattccaccttactggatatggttccattacctatcactggtgaag |
40382797 |
T |
 |
| Q |
201 |
tacccttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtcaaagggattcagatgtttgataacactccgcttggtga |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382796 |
tacccttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtcaaagggattcagatgtttgataacactccgcttggtga |
40382699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University