View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_1D_low_40 (Length: 201)
Name: NF2853_1D_low_40
Description: NF2853_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_1D_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 13 - 178
Target Start/End: Original strand, 48214871 - 48215034
Alignment:
| Q |
13 |
tttggagttagttagagatcgtaaaagtttgttagaagactctagaacaataaatagttgatattgtacatttctcattttcatcactcaatatatgaga |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48214871 |
tttggagttagttagagattgtaaaagtttgttaaaagactctagaacgataaatagttgatattgtacatttctcattttcatcactcaatatatgaga |
48214970 |
T |
 |
| Q |
113 |
tttgattaagatttttatctctctgttagtttgttaagattttctctcaattcacctatgaattct |
178 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48214971 |
tttgattaagattttta--tctctgttattttgttaagattttctctcaattcaccaatgaattct |
48215034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University