View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_1D_low_41 (Length: 201)
Name: NF2853_1D_low_41
Description: NF2853_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_1D_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 6 - 190
Target Start/End: Original strand, 28324973 - 28325157
Alignment:
| Q |
6 |
acttttcacttctctctttgtccctgcaacaacaattatgcttccaattctcttctttcctttcccctttccaaaaccatgaaaaagcgcttattttcaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28324973 |
acttttcacttctctctttgtccctgcaacaacaattatgcttccaattctcttctttcctttcccctttccaaaaccatgaaaaagcgcttattttcaa |
28325072 |
T |
|
| Q |
106 |
atcactactcatatcgcaaattccgtagnnnnnnntggaccctttattcctcttctattcaaaaacaatctgcaactacttccaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28325073 |
atcactactcatatcgcaaattccgtagaaaaaaatggaccctttattcctcttctattcaaaaacaatctgcaactacttccaa |
28325157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University