View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_high_15 (Length: 311)
Name: NF2853_2D_high_15
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 27 - 262
Target Start/End: Original strand, 23016404 - 23016639
Alignment:
| Q |
27 |
tgactctcccaatgctttccctatctcttggcttatcggnnnnnnnnnnnnnnnnnntttatacatttcaataatgtttctcgtatcaccacactagtgt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23016404 |
tgactctcccaatgctttccctatctcttggcttatcggaaaaataaaagcaaaaaatttatacatttcaattatgtttctcgtatcaccacactagtgt |
23016503 |
T |
 |
| Q |
127 |
ggatactttactaaaagggttcagtaaaaaatcaagcatttataaatcacaaatgtaaattcgtgatcagttaaaaattcaaaataacatgtgaaacgca |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
23016504 |
ggatactttactaaaagggttcggtaaaaaatcaagcatttataaatcacaaatgtaaattcgtgatcagttaaaaattcaaaataacatgtgcaatgca |
23016603 |
T |
 |
| Q |
227 |
aggtttagcatttagtttttattgaatgggaaggaa |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23016604 |
aggtttagcatttagtttttattgaatgggagggaa |
23016639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 252 - 296
Target Start/End: Complemental strand, 23016252 - 23016208
Alignment:
| Q |
252 |
atgggaaggaattggcgcctcaaaaacccaagagaatctgatgtc |
296 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
23016252 |
atgggaaggaatcggcgcctcaaaaacccaagagaatccgatgtc |
23016208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University