View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_high_24 (Length: 251)
Name: NF2853_2D_high_24
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 1187742 - 1187966
Alignment:
| Q |
9 |
atgaatgatggatgaattgcatctagtgacaaatttcaattaaaaatgccaatgccaatgccatgctgaatcgtacgtacacacacattctttgccgttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187742 |
atgaatgatggatgaattgcatctagtgacaaatttcaattaaaaatgccaatgccaatgccatgctgaatcgtacgtacacacacattctttgccgttc |
1187841 |
T |
|
| Q |
109 |
tggtgttgaattgtgtcatattgtgtgagctagctgtttttatgtccaaattgaaggtttttcatgtgtaagaggcacaactccctctttgcctattcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187842 |
tggtgttgaattgtgtcatattgtgtgagctagctgtttttatgtccaaattgaaggtttttcatgtgtaagaggcacaactccctctttgcctattcat |
1187941 |
T |
|
| Q |
209 |
tcctttccttgcagtacaagtacat |
233 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1187942 |
tcctttccttgcagtacaagtacat |
1187966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University