View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_low_28 (Length: 339)
Name: NF2853_2D_low_28
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_low_28 |
 |  |
|
| [»] scaffold0274 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 22 - 312
Target Start/End: Original strand, 33368155 - 33368445
Alignment:
| Q |
22 |
aagttattaactttgcttgttgcttcatgtgagctttgttagtactagaatcggtttaccaagtgaacgtcctgattgcaacattgctggttttggttat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368155 |
aagttattaactttgcttgttgcttcatgcgagctttgttagtactagaatcggtttaccaagtaaacgtcctgattgcaacattgctggttttggttat |
33368254 |
T |
 |
| Q |
122 |
atagtggtttgctattttcttttgcttatgaacaagaggggtgtataaccctttggactacggtttaggcagatctcaaatcatgtagttgtttcttctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368255 |
atagtggtttgctattttcttttgcttatgaacaagaggggtgtataaccctttggactacggtttaggcagatctcaaatcatgtagttgtttcttctt |
33368354 |
T |
 |
| Q |
222 |
aggttgttatattatgggaatctggatggttttaaaaactgataggctgtgattatggctgcaacatttaggtttttgatgtatgcagccg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368355 |
aggttgttatattatgggaatctggatggttttaaaaactgatgggctgtgattatggctgcaacatttaggtttttgatgtatgcagccg |
33368445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 194 - 257
Target Start/End: Original strand, 33360700 - 33360763
Alignment:
| Q |
194 |
atctcaaatcatgtagttgtttcttcttaggttgttatattatgggaatctggatggttttaaa |
257 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||| || |||| || ||||||||||| |
|
|
| T |
33360700 |
atctcgaattatgtagttgtttcttcttagattgttatattgtgagaatatgaatggttttaaa |
33360763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 79
Target Start/End: Original strand, 33360606 - 33360647
Alignment:
| Q |
38 |
ttgttgcttcatgtgagctttgttagtactagaatcggttta |
79 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
33360606 |
ttgttgctgcatatgagctttgttagtactagaatctgttta |
33360647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 38 - 124
Target Start/End: Complemental strand, 14607 - 14521
Alignment:
| Q |
38 |
ttgttgcttcatgtgagctttgttagtactagaatcggtttaccaagtgaacgtcctgattgcaacattgctggttttggttatata |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| |||||| | | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
14607 |
ttgttgcttcatgtgagctttgttagtaccagaataggtctaccaatagtatgtcctgattgcaacattgctagttttggttatata |
14521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 220 - 312
Target Start/End: Complemental strand, 14362 - 14269
Alignment:
| Q |
220 |
ttaggttgttatattatgggaatctggatggttttaaaaactgat--aggctgtgattatggctgcaacatttaggtttttgatgtatgcagccg |
312 |
Q |
| |
|
||||| |||| ||| || ||||| || |||||||||||||||||| |||||||||| | |||||||| ||||||||||||| |||||||||| |
|
|
| T |
14362 |
ttaggctgttgtatgataggaatatgaatggttttaaaaactgatcagggctgtgatttttactgcaaca-ttaggtttttgatatatgcagccg |
14269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 38 - 124
Target Start/End: Original strand, 41430276 - 41430362
Alignment:
| Q |
38 |
ttgttgcttcatgtgagctttgttagtactagaatcggtttaccaagtgaacgtcctgattgcaacattgctggttttggttatata |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||| | | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
41430276 |
ttgttgcttcatgtgagctttgttagtactagaataggtctaccaatagtatgtcctgatcgcaacattgctagttttggttatata |
41430362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 266 - 339
Target Start/End: Original strand, 41440245 - 41440318
Alignment:
| Q |
266 |
ggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgtggccgcaattgtagtagcatcaaccc |
339 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||| | |||||||| ||||| |||||||| |
|
|
| T |
41440245 |
ggctgtgattgtggctgcaacatttaggtttttgatgcatgcagccgcgatcgcaattgcagtagtatcaaccc |
41440318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 220 - 312
Target Start/End: Original strand, 41430521 - 41430614
Alignment:
| Q |
220 |
ttaggttgttatattatgggaatctggatggttttaaaaactgata--ggctgtgattatggctgcaacatttaggtttttgatgtatgcagccg |
312 |
Q |
| |
|
||||| |||| ||| |||||||| || ||| ||||||||||| || |||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
41430521 |
ttaggctgttgtatgatgggaatatgaatgattttaaaaacttatcagggctgtgatttttactgcaacatt-aggtttttgatgtatgcagccg |
41430614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University