View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2853_2D_low_31 (Length: 327)

Name: NF2853_2D_low_31
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2853_2D_low_31
NF2853_2D_low_31
[»] chr2 (2 HSPs)
chr2 (1-309)||(6490974-6491282)
chr2 (122-247)||(41869846-41869970)
[»] chr3 (1 HSPs)
chr3 (54-229)||(15297648-15297822)
[»] chr5 (2 HSPs)
chr5 (57-271)||(39709506-39709719)
chr5 (54-229)||(39718196-39718370)


Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 6491282 - 6490974
Alignment:
1 ataaacaactggaatgtttggaaaaacccaacatactttcatcactcgaccacattacataaacaagttcggcttcttggccttgtatgttgtcttcagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6491282 ataaacaactggaatgtttggaaaaacccaacatactttcatcactcgaccacattacataaacaagttcggcttcttggccttgtatgttgtcttcagc 6491183  T
101 ttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttggaatcgtggaattgtttggtgctctccctcttgcaaagcttggctggg 200  Q
    ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6491182 ttcttgggtggtggtgtgattttcttgaaaaccaatgggaacttgatctttggaatcgtggaattgtttggtgctctccctcttgcaaagcttggctggg 6491083  T
201 atggtggcagtcttaataatctgaatgcaggggaaacagaccctatgtcgtgaagccgtctcattgtacatcagatcaactgcgccatttagagtggtgt 300  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6491082 atggtggcagtcttaataatctgaatgcaggggaaacaaaccctatgtcgtgaagccgtctcattgtacatcagatcaactgcgccatttagagtggtgt 6490983  T
301 cacggaact 309  Q
    |||||||||    
6490982 cacggaact 6490974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 122 - 247
Target Start/End: Complemental strand, 41869970 - 41869846
Alignment:
122 ttcttgaaaaccaatgggagcttgatctttggaatcgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatc 221  Q
    |||||| | ||||| |||| |||||| |||||||| |||||| || || ||||||||||| ||||| || || |||||||||||||| |||||||| |||    
41869970 ttcttgtacaccaaggggaacttgat-tttggaattgtggaactgcttagtgctctcccttttgcacagattagctgggatggtggccgtcttaatgatc 41869872  T
222 tgaatgcaggggaaacagaccctatg 247  Q
    || ||||| || || | |||||||||    
41869871 tggatgcaaggaaatctgaccctatg 41869846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 54 - 229
Target Start/End: Complemental strand, 15297822 - 15297648
Alignment:
54 attacataaacaagttcggcttcttggccttgtatgttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttgg 153  Q
    |||||||||||| ||| || ||  | ||||||||||||||||| |||||| ||| ||| ||  | || |||||||| ||||| |||| |||||| ||| |    
15297822 attacataaacatgttgggttttgttgccttgtatgttgtcttgagcttcctggttgggggcctaatcttcttgaacaccaacgggaacttgat-tttag 15297724  T
154 aatcgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatctgaatgca 229  Q
    | | ||| || ||||| ||||||||||| |||||||| || |||||||| ||||||||||| || ||||| |||||    
15297723 agttgtgaaactgtttcgtgctctcccttttgcaaaggttagctgggattgtggcagtcttgatgatctggatgca 15297648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 57 - 271
Target Start/End: Complemental strand, 39709719 - 39709506
Alignment:
57 acataaacaagttcggcttcttggccttgtatgttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttggaat 156  Q
    ||||||||| ||| ||||||||||| ||||| ||||| || ||  || | | ||||||  | || |||||| | ||||  |||| |||||| ||||||||    
39709719 acataaacaggttgggcttcttggctttgtaggttgtttttaggctcctagttggtggcctaatcttcttgtacaccagagggaacttgat-tttggaat 39709621  T
157 cgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatctgaatgcaggggaaacagaccctatgtcgtgaagc 256  Q
     ||| || || || ||||||||||| ||||| || || || |||||||||||||||||||| || ||||||||||| || | ||||||||| || || ||    
39709620 tgtgaaactgcttagtgctctcccttttgcacagattagccgggatggtggcagtcttaatgatttgaatgcagggaaacctgaccctatgacgagatgc 39709521  T
257 cgtctcattgtacat 271  Q
    | |||| ||||||||    
39709520 catctcgttgtacat 39709506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 229
Target Start/End: Complemental strand, 39718370 - 39718196
Alignment:
54 attacataaacaagttcggcttcttggccttgtatgttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttgg 153  Q
    |||||||||||| ||| |||||||| || ||||| ||||| || ||  || ||| ||||||  | || |||||| | ||||  |||| |||||| |||||    
39718370 attacataaacaggttgggcttcttagctttgtaggttgttttgaggctcctggttggtggcctaatcttcttgtacaccagagggaacttgat-tttgg 39718272  T
154 aatcgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatctgaatgca 229  Q
    ||| ||| || || || |||||||| || ||||| || || ||||||||||||||||||||||| || ||||||||    
39718271 aattgtgaaactgcttagtgctctctcttttgcacagattagctgggatggtggcagtcttaatgatttgaatgca 39718196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University