View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_low_39 (Length: 306)
Name: NF2853_2D_low_39
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 1927625 - 1927328
Alignment:
| Q |
1 |
cccagccacaacaggccagatgggtatcctcccaggacatgtttcaacaattgcagagttgaaacctggggtcatgattgtacaagaagggaatgattcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1927625 |
cccagccacaacaggccagatgggtatcctcccaggacatgtttcaacaattgcagagttgaaacctggggtcatgattgtacaagaagggaatgattcg |
1927526 |
T |
 |
| Q |
101 |
accaagtattttgtaagcagtggctttgctttcgtccatgcaaactctgttgctgatataatcgctgttgaggccgttccactggatcaaattgatgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1927525 |
accaagtattttgtaagcagtggcttcgctttcgtccatgcaaactctgttgctgatataatcgctgttgaggccgttccactggatcaaattgatgcaa |
1927426 |
T |
 |
| Q |
201 |
gcctagtgcagaagggtcttcaagagttcactcagaagctcagctcagcgacaactgatttggagaaagctgaagctcagattggagttgatgtccat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1927425 |
gcctagtgcagaagggtcttcaagagttcactcagaagctcagctcagcgacaactgatttggagaaagctgaagctcagattggagttgatgtccat |
1927328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University