View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_low_59 (Length: 241)
Name: NF2853_2D_low_59
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_low_59 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 102 - 241
Target Start/End: Original strand, 34674871 - 34675010
Alignment:
| Q |
102 |
tggaaatcactcgtacttgagagcatagattgttgtggcaagtgtgaggtgagtaagaattcacatatttcttaaaaaagtagaggttgaacaatttaca |
201 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34674871 |
tggaaatcactcgtacttgagagtggagattgttgtggcaagtgtgaggtgagtaagaattcacatatttcttaaaaaagtagaggttgaacaatttaca |
34674970 |
T |
|
| Q |
202 |
agtgaaatgtccataaatctattatcttaaaatttcggat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34674971 |
agtgaaatgtccataaatctattatcttaaaattttggat |
34675010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 34674868 - 34674763
Alignment:
| Q |
1 |
cactatactccccttcaagtgtaagctttttcatccacacacacttacttgcactgccattggttctctttcaaccgaacacgtcacttgaacatcattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34674868 |
cactatactccccttcaagtgtaagctttttcatccacacacacttacttgcactgccattggttctctttcaacagaacacgtcacttgaacatcattc |
34674769 |
T |
|
| Q |
101 |
gtggaa |
106 |
Q |
| |
|
|||||| |
|
|
| T |
34674768 |
gtggaa |
34674763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University