View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_low_62 (Length: 229)
Name: NF2853_2D_low_62
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 42523588 - 42523377
Alignment:
| Q |
1 |
caattgaagaaagataatagaatattcgtgcatttgtgaaatgttggaaactctcaagttcnnnnnnnnn-gcttctcttcaatgggactttagatgctt |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42523588 |
caattgaagaaagataatagaatatttgtgcatttgtgaaatgtcggaaactctcaagttcttttttttttgcttctcttcaatgggactttagatgctt |
42523489 |
T |
|
| Q |
100 |
atcaaaactccatttttattttcaggaaagggtttctgatcctgcagcaaaatcatctcattttgctgctcgacccagtgtccctccatatgcgccacca |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42523488 |
accaaaactccatttttattttcaggaaagggtttctgatcctgcagcaaaatcatctcattttgctgctcgacccagtgtccctccatatgcgccacca |
42523389 |
T |
|
| Q |
200 |
atgattactatg |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42523388 |
atgattactatg |
42523377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University