View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_low_65 (Length: 225)
Name: NF2853_2D_low_65
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_low_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 5265435 - 5265280
Alignment:
| Q |
1 |
acttcggaagaccggtgatgttgataaactgagaaaagcaagggaagttatgactgaaatctttccattgaccccttccttgtggcagcagtggattaaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265435 |
acttcggaaaaccggtgatgttgataaactgagaaaagcaagggaagttatggctgaaatctttccattgaccccttccttgtggcagcagtggattaaa |
5265336 |
T |
 |
| Q |
101 |
gatgagctttctctcaccaccgccaagaatgacactttctctaccgttgttaagct |
156 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5265335 |
gatgagctttctctcaccaccgccaataatgacactttctctaccgttgttaagct |
5265280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 147 - 206
Target Start/End: Original strand, 5265558 - 5265617
Alignment:
| Q |
147 |
ttgttaagctcagaagcattaaaagaaaagtaaagaaataagaattacttgcaaatgagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265558 |
ttgttaagctcagaagcattaaaagaaaagtaaagaaataagaattacttgcaaatgagc |
5265617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University