View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_2D_low_75 (Length: 208)
Name: NF2853_2D_low_75
Description: NF2853_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_2D_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 13 - 168
Target Start/End: Original strand, 38750343 - 38750498
Alignment:
| Q |
13 |
gagtatggagtttataagcctgaagagatgaaggggaaccagatgaaagaaggtattgcatattacaccttttgtgcaagcatcgagttaaacgaagtag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750343 |
gagtatggagtttataagcctgaagagatgaaggggaaccagatgaaagaaggtattgcatattacaccttttgtgcaagcatcgagttaaacgaagtag |
38750442 |
T |
 |
| Q |
113 |
aaaatgattggtttttgggacatgaaaagagaatagatgaattcttctaatattca |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750443 |
aaaatgattggtttttgggacatgaaaagagaatagatgaattcttctaatattca |
38750498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University