View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_high_12 (Length: 233)
Name: NF2853_high_12
Description: NF2853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 218
Target Start/End: Original strand, 8003464 - 8003659
Alignment:
| Q |
23 |
gaagtaccttaatcccaacttttgatgtttccataacgccacataagnnnnnnnataaggttgtaacttaaccaacgcctgaccattcacttggaactct |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8003464 |
gaagtaccttaatcccaacttttgatgtttccataacgccacataagtttttctataaggttataacttaaccaacgcctgactattcacttggaactct |
8003563 |
T |
 |
| Q |
123 |
acatgacgacgctttttgtcggcttggaatttaatagcttattgtcctatgtataggtttgtttgcagttgggacaataactctttacggtctgtg |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8003564 |
acattacgacgctttttgtcggcttggaatttaatagcttattgtcctatgtataagtttgtttgcagttgggacaataactctttacggtttgtg |
8003659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University