View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_low_19 (Length: 212)
Name: NF2853_low_19
Description: NF2853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 39 - 192
Target Start/End: Complemental strand, 4238872 - 4238715
Alignment:
| Q |
39 |
tttttattattatatcacggttttaattagttgaatattcaatagatcatactattgtcatgcaagtattattctgtacttaaacttaatttgattgata |
138 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4238872 |
ttttttttattatatcacggttttaattagttgaatattcaatagatcatactagagtcatgcaagtattattccgtacttaaacttaatttgattgata |
4238773 |
T |
|
| Q |
139 |
tttgaattatatctggttacatatata----gttaacatgaaaacatgttggtgcagt |
192 |
Q |
| |
|
||| |||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4238772 |
tttcaattatgtctggttacatatatagttagttaacatgaaaacatgttggtgcagt |
4238715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 36 - 157
Target Start/End: Complemental strand, 19921039 - 19920922
Alignment:
| Q |
36 |
taatttttattattatatcacggttttaattagttgaatattcaatagatcatactattgtcatgcaagtattattctgtacttaaacttaatttgattg |
135 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19921039 |
taatttttaatattatatcacggttttaattagttgaatattcaatagatcacactagagtcatgcaagtattattccat-cttaaacttaatttgat-- |
19920943 |
T |
|
| Q |
136 |
atatttgaattatatctggtta |
157 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
19920942 |
-tatttgaattatatctagtta |
19920922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University