View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_low_5 (Length: 348)
Name: NF2853_low_5
Description: NF2853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 133 - 330
Target Start/End: Original strand, 41908054 - 41908251
Alignment:
| Q |
133 |
actagaaattgcataaccacataagctgaacgttcacctccaccataaggcacataagtgtaaggattaggaggagcataagtactaggtggtccataag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41908054 |
actagaaattgcataaccacataagctgaacgttcacctccaccataaggcacataagtgtaaggattaggaggagcataagtactaggtggtccataag |
41908153 |
T |
|
| Q |
233 |
tattataaggattagtaggaggtccataaatgtaaggagcaggaggtgtacaacactgaacaccaccagctggaggacacttactctgccctttctca |
330 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41908154 |
tatcataaggattagtaggaggtccatagatgtaaggagcaggaggtgtacaacactgaacaccaccagcaggaggacacttactctgccctttctca |
41908251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 41907937 - 41907989
Alignment:
| Q |
16 |
acaacaacattttagtattgacaacctgatttactagtacatacgataatcac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41907937 |
acaacaacattttagtattgacaacctgatttactagtacatacgataatcac |
41907989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University