View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2853_low_6 (Length: 323)
Name: NF2853_low_6
Description: NF2853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2853_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 29473728 - 29473838
Alignment:
| Q |
17 |
atcttttgtttttatttcaattttctatgtcatcttctgttatgtcttgaacttctcaattttctcatgttcacacacactatatgtgtttagcttctgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29473728 |
atcttttgtttttatttcaattttctatgtcatcttctgttatgtcttgaacttctcaatttt-tcatgttcacacacactatatgtgtttagcttctgt |
29473826 |
T |
|
| Q |
117 |
tcttgtcaagta |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29473827 |
tcttgtcaagta |
29473838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 210 - 323
Target Start/End: Original strand, 29473920 - 29474033
Alignment:
| Q |
210 |
aaaaaatgggattggagttaaatttccactcaaaaaatgtgttttttcagttttatatgattttattgtttagtcttggaatcttctttgtaagttcaat |
309 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29473920 |
aaaaaatgggattggagttaagtttcagctcaaaaaatgtgttttttcacttttacatgattttattgtttagtcttggaatcttctttgtaagttcaat |
29474019 |
T |
|
| Q |
310 |
caatgaagaaggtt |
323 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29474020 |
caatgaagaaggtt |
29474033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University