View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2855_high_3 (Length: 238)
Name: NF2855_high_3
Description: NF2855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2855_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 39266096 - 39265981
Alignment:
| Q |
104 |
atgttgcgagtttgatgctttatgattgttggaagagatgaatttagtgttatgaactataggttttgaattcaacttacaacactgccataagacccat |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| || || |
|
|
| T |
39266096 |
atgttgcgagtttgatgctttataattgttggaagagatgaatttagtgttatgaactataggttttgaattcaatttacagcactgccatgtgagagat |
39265997 |
T |
|
| Q |
204 |
tgagaagagataaaat |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39265996 |
tgagaagagataaaat |
39265981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 219
Target Start/End: Complemental strand, 45638605 - 45638545
Alignment:
| Q |
157 |
gaactataggttttgaattcaacttacaacactgccataagacccattgagaagagataaaat |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
45638605 |
gaactatagcttttgaattcaacttacaacactggcatgaga--gattgagaagagataaaat |
45638545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 49155986 - 49155929
Alignment:
| Q |
111 |
gagtttgatgctttatgattgttggaagagatgaatttagtgttatgaactataggtt |
168 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||| |||||||||||||| |||| |||| |
|
|
| T |
49155986 |
gagtttgatgctttataattattggaagaaatggatttagtgttatgagctattggtt |
49155929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 49156102 - 49156045
Alignment:
| Q |
9 |
tgcgtttcatggatctgggtgtgttttttctcattatttaattacgtagttgattaag |
66 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||| |||||||||| || |||||| |
|
|
| T |
49156102 |
tgcgtttcatggatctagatgtgtttttcctcattatgtaattacgtaattcattaag |
49156045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University