View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2855_low_3 (Length: 322)
Name: NF2855_low_3
Description: NF2855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2855_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 318
Target Start/End: Original strand, 13909036 - 13909340
Alignment:
| Q |
19 |
ccaacccccttttgccacctataaaacattttcctaagcagcacttgcacacatgtatagtacatatttctcagtcctcacacaccgacacaccttaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13909036 |
ccaacccccttttgccacctataaaacattttcctaagcagcacttgcacacatgtatagtacatatttctcagtcctcacacaccgacacaccttaatt |
13909135 |
T |
|
| Q |
119 |
ttcactatacaatatatacacatcactatctactcaaattctacaacatatattcatcactatctattccaattctcattccttttccctctataaatag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13909136 |
ttcactatacaatatatacacatcactatctactcaaattctacaacatatattcatcactatctattccaattctcattccttttccctctataaatag |
13909235 |
T |
|
| Q |
219 |
ctaacacaaccgccatctctcaccttattgttttgtgcactcaactattataccataccatgcaacta-----ttcacttactaattcttgtttagattt |
313 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13909236 |
ctaaaacaaccgccatctctcaccttattgttttgtgcactcaactattataccataccatgcaactattcacttcacttactaattcttgtttagattt |
13909335 |
T |
|
| Q |
314 |
ttctc |
318 |
Q |
| |
|
||||| |
|
|
| T |
13909336 |
ttctc |
13909340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University