View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2856-Insertion-16 (Length: 472)
Name: NF2856-Insertion-16
Description: NF2856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2856-Insertion-16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 348 - 472
Target Start/End: Complemental strand, 41287722 - 41287598
Alignment:
| Q |
348 |
agttaaaatgggaaatacaatatgatacaactatacttaacagtttacaaattcattcaaacacaaattcaatgtttgtcacaaatatcatattcaagtg |
447 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41287722 |
agttaaaatgtgttatacaatatgatacaactatacttaacagtttacaaattcattcaaacacaaattcaatgtttgtcacaaatatcatatgcaagtg |
41287623 |
T |
 |
| Q |
448 |
taaacgacatctagtaaaattattt |
472 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41287622 |
taaacgacatctagtaaaattattt |
41287598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University