View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2856-Insertion-23 (Length: 95)
Name: NF2856-Insertion-23
Description: NF2856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2856-Insertion-23 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 7e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 7e-43
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 24614696 - 24614609
Alignment:
| Q |
8 |
cttatgggaccttctggttctggaaaatcaactcttcttgatgcactttctagtcgtttagcttctaatgcttttctttctggtacta |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24614696 |
cttatgggaccttctggttctggaaaatcaactcttcttgatgcactttctagtcgtttagcttctaatgcttttctttctggtacta |
24614609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 29476616 - 29476658
Alignment:
| Q |
9 |
ttatgggaccttctggttctggaaaatcaactcttcttgatgc |
51 |
Q |
| |
|
||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
29476616 |
ttatgggtccatctggttctggaaaatctactcttcttgatgc |
29476658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University