View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2856-Insertion-25 (Length: 62)
Name: NF2856-Insertion-25
Description: NF2856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2856-Insertion-25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 7 - 62
Target Start/End: Complemental strand, 22333802 - 22333747
Alignment:
| Q |
7 |
aattagaaggtgattaatttaaggtttgacttttgaatatgtactaggctagcttc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22333802 |
aattagaaggtgattaatttaaggtttgacttctgaatatgtactaggctagcttc |
22333747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University