View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2856_low_12 (Length: 262)
Name: NF2856_low_12
Description: NF2856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2856_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 26 - 247
Target Start/End: Complemental strand, 41994383 - 41994162
Alignment:
| Q |
26 |
atcatcatgactgaccttgttgagaaacagcaagatgggtgtggtctaagaaacagaatatcttcatacagatttccaaaggtaaggtttccattttgag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41994383 |
atcatcatgactgaccttgttgagaaacagcaagatgggtgtggtctaagaaacagaatatcttcatacagatttccaaaggtaaggtttccattttgag |
41994284 |
T |
 |
| Q |
126 |
gattagattaaagaattcagttcattcatgcaacaaaaacagtaactagttttgtttcaagaaagagnnnnnnnggtagtaacagtttctttggattctg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41994283 |
gattagattaaagaattcagttcattcatgcaacaaaaacagtaactagttttgtttcaagaaagagaaaaaaaggtagtaacagtttctttggattctg |
41994184 |
T |
 |
| Q |
226 |
tttttgtggtcatgtttctaat |
247 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
41994183 |
tttttgtggtcctgtttctaat |
41994162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University