View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2856_low_15 (Length: 237)
Name: NF2856_low_15
Description: NF2856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2856_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 15198206 - 15197989
Alignment:
| Q |
1 |
atacggtgaatcatggtactgggacaaccgttacacaaacgaacctggtccttttgattggtaccaaaagtatattactttgtctcctatcatcaatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15198206 |
atacggtgaatcatggtactgggacaaccgttacacaaacgaacctggtccttttgattggtaccaaaagtatattactttggctcctatcatcaatctc |
15198107 |
T |
 |
| Q |
101 |
tatgttcccaagaaccaatctatccttgttgttggttctggtaattcaggcaagtcaatccaaaaataccannnnnnnncttctcttagatctctcttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
15198106 |
tatgttcccaagaaccaatctatccttgttgttggttctggtaattcaggcaagtcaatccaaaaataccatttttcttct--tcttagatctctcttat |
15198009 |
T |
 |
| Q |
201 |
agtatgatatttaatgccac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15198008 |
agtatgatatttaatgccac |
15197989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University