View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2857_low_15 (Length: 219)
Name: NF2857_low_15
Description: NF2857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2857_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 205
Target Start/End: Complemental strand, 7126711 - 7126518
Alignment:
| Q |
12 |
atcatcaagctcttgcaaccagctaaggagaatcgaaggagccgttacataattccaccacatatttgcataaatcttgacgtgtttaacagaactagga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7126711 |
atcagcaagctcttgcaaccagctaaggagaatcgaaggagcagttacataattccaccacatatttgcataaatcttgacgtgtttaacagaactagga |
7126612 |
T |
|
| Q |
112 |
ttgtttcctgatagtatctcgaaaggtgtaccgacaaaagcaaaagtacaaagacctggcgtcaataactcaattttgcagtggtttttcttgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7126611 |
ttgtttcctgatagtatctcgaaaggtgtaccgacaaaagaaaaagtacaaagacctggcgttgataactcaattttgcagtagtttttcttgg |
7126518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 123 - 188
Target Start/End: Original strand, 7103676 - 7103741
Alignment:
| Q |
123 |
tagtatctcgaaaggtgtaccgacaaaagcaaaagtacaaagacctggcgtcaataactcaatttt |
188 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||| | |||||||| |||||| ||||||||||||| |
|
|
| T |
7103676 |
tagtatctgaaaaggagtaccgacaaaaacaaaggaacaaagacttggcgtagataactcaatttt |
7103741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University