View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2857_low_8 (Length: 313)
Name: NF2857_low_8
Description: NF2857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2857_low_8 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 15043 - 15304
Alignment:
| Q |
18 |
caaaatgtatacagaaataatattttcttgttagtaaaagatatttataattatattaaacaagtaagagaggtttcaatcaacaaaaattagagaggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15043 |
caaaatgtatacagaaataatattttcttgttagtaaaagatatttataattatattaaacaagtaagagaggtttcaatcaacaaaaattagagagg-- |
15140 |
T |
|
| Q |
118 |
aaaaacaaaagtatcattgtgctaaataatagaaaaatagccgttcatatatcctaaatgtagctgtgaaatttggtacnnnnnnnnnnnnnnnnnnnnn |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15141 |
------------atcattgtgctaaataatagaaaaatagccgttcatatatcctaaatgtagctctgaaatttggtacaaaacaaagaaaaagaaacga |
15228 |
T |
|
| Q |
218 |
nnnntcttattacatggaaagataatgacgatggaatagattgaaaaaacttattttatagatgagttcgatacac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15229 |
aaaatcttattacatggaaagataatgacgatggaatagattgaaaaaacttattttatagatgagttcgatacac |
15304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University