View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_high_11 (Length: 305)
Name: NF2858_high_11
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 287
Target Start/End: Original strand, 17236119 - 17236388
Alignment:
| Q |
18 |
atgaaagtaggcccaggtaattcaacaccgttgatccgagctccgtccctcttggaacggctgacgtcggggaattttcgtcgattagattcggtaaagg |
117 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17236119 |
atgaaaggaggcctaggtaattcaacaccgttgatccgagctccgtccctcttggaacggctgatgtcggggaattttcgtcgattagattcggtaaagg |
17236218 |
T |
|
| Q |
118 |
tggtggaggaggagaagaaagctgagtcagaagtggaactcaaacctgagagggagattgtaagaggaagggtagaagaggaagaagttgatgcaaaggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17236219 |
tggtggaggaggagaagaaagctgagtcagaagtggaactcaaacctgagagggagattgtaagaggaagggtagaagaggaagaagttgatgcaaaggc |
17236318 |
T |
|
| Q |
218 |
tgatgattttataaagaggtttaagcagcaacttaggttggaaaggcttgattctattttacgttataga |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17236319 |
tgatgattttataaagaggtttaagcagcaacttaggttggaaaggcttgattctattttacgttataga |
17236388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 272
Target Start/End: Complemental strand, 52483704 - 52483623
Alignment:
| Q |
191 |
agaagaggaagaagttgatgcaaaggctgatgattttataaagaggtttaagcagcaacttaggttggaaaggcttgattct |
272 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||| ||||| ||||||||| ||||||| ||||| | |||||||||||| |
|
|
| T |
52483704 |
agaagatgaagctgttgatgcaaaagctgatgatttcataaacaggtttaagaagcaactccggttgcagaggcttgattct |
52483623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 272
Target Start/End: Complemental strand, 52464531 - 52464465
Alignment:
| Q |
206 |
tgatgcaaaggctgatgattttataaagaggtttaagcagcaacttaggttggaaaggcttgattct |
272 |
Q |
| |
|
||||||||| ||||||||||||||||| | ||||||| ||||| | |||||| | |||||| ||||| |
|
|
| T |
52464531 |
tgatgcaaaagctgatgattttataaacatgtttaagaagcaattgaggttgcagaggcttaattct |
52464465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University