View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_high_14 (Length: 264)
Name: NF2858_high_14
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 91 - 238
Target Start/End: Complemental strand, 32738080 - 32737933
Alignment:
| Q |
91 |
ggtaaataaaattcaattttcaagtcagaggttccgggctttatgtgatgagctcgagatacaactaaagtttgcctcagttgtacacgcccaagcaaac |
190 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32738080 |
ggtaaataaaattcaatttgcaagtcagaggttcagggctttctgtgatgagctcgagatacaactaaagtttgcctcagttgaacacgcccaagcaaac |
32737981 |
T |
|
| Q |
191 |
gagtaggttgaataagcaaacaaggtcatcctcaacagtttgaggaag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32737980 |
gagtaggttgaataagcaaacaaggtcatcctcaacagtttgaggaag |
32737933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 32738199 - 32738106
Alignment:
| Q |
1 |
catctttgatgctgagacacaaccttagcagttatgtccactattacagtgaaaaaggtgcacaagtttatttcaagaattcagtttactggta |
94 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32738199 |
catctttgatgctgagacacactcttagcagttatgtccactattacagtgaaaaaggtgcacaagtttatttcaagaattcagtttactggta |
32738106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University