View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_high_24 (Length: 239)
Name: NF2858_high_24
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 1235655 - 1235864
Alignment:
| Q |
18 |
gattgaacttactgtacattatttggtctagcacaactctttctagttcaattaacatagatactcgatcaaaccggatacatccgttatgtgtgtgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1235655 |
gattgaacttactgtacattatttggtctagcacaactctttctagttcaattaacatagatactcgatcaaaccggatacatccgttatgtgtatgtta |
1235754 |
T |
 |
| Q |
118 |
gattttaagtagtcattgttatttcgtctttatacatagaaaaacattgagtttgtcatatttaaccactattatattggtctaaattcatgtttctaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1235755 |
gattttaagtagtcattgttatttcgtctttatacatagaaaaacattgggtttgtcatatttaaccactattatattggtctaaattcatgtttctaat |
1235854 |
T |
 |
| Q |
218 |
aattaaactt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
1235855 |
aattaaactt |
1235864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University