View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2858_high_27 (Length: 238)

Name: NF2858_high_27
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2858_high_27
NF2858_high_27
[»] chr5 (4 HSPs)
chr5 (1-223)||(10267609-10267841)
chr5 (29-173)||(10284691-10284835)
chr5 (29-131)||(10283028-10283130)
chr5 (38-126)||(10292502-10292590)
[»] chr4 (1 HSPs)
chr4 (96-213)||(41883551-41883668)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 10267609 - 10267841
Alignment:
1 aatataagcaataggagcaaggatagaaagagcaagtagatctctgtagaggcaaaaaaccaactgattaaccccaacattaagggctactttggtaata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10267609 aatataagcaataggagcaaggatagaaagagcaagtagatctctgtagaggcaaaaaaccaactgattaaccccaacattaagggctactttggtaata 10267708  T
101 acatggtaaccaccattgaatagctgcaccattgccatagccaaatgggctttccatgcgtcacttcccattgatgttgccattg----------aaatt 190  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||          |||||    
10267709 acgtggtaaccaccattgaatagctgcaccattgccatagccaaatgggctttccatgtgtcacttcccattggtgttgccattgaaaaacaccaaaatt 10267808  T
191 ctagcttgatttctgaaattcaaacacaaagat 223  Q
    |||||||||||||||||||||||||||||||||    
10267809 ctagcttgatttctgaaattcaaacacaaagat 10267841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 173
Target Start/End: Complemental strand, 10284835 - 10284691
Alignment:
29 agagcaagtagatctctgtagaggcaaaaaaccaactgattaaccccaacattaagggctactttggtaataacatggtaaccaccattgaatagctgca 128  Q
    |||||||| ||||| || |||| ||| || || || || || || ||| |||||||||| || || ||||| |||||||| ||||||||||||||||| |    
10284835 agagcaaggagatccctatagaagcagaagactaattggttgactccagcattaagggccaccttagtaatgacatggtagccaccattgaatagctgta 10284736  T
129 ccattgccatagccaaatgggctttccatgcgtcacttcccattg 173  Q
    | | ||||||  |||||||||| |||||||| |||||||||||||    
10284735 caactgccatgcccaaatgggccttccatgcttcacttcccattg 10284691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 131
Target Start/End: Original strand, 10283028 - 10283130
Alignment:
29 agagcaagtagatctctgtagaggcaaaaaaccaactgattaaccccaacattaagggctactttggtaataacatggtaaccaccattgaatagctgca 128  Q
    |||||||| |||||||| |||| ||| || || |  || || || |||||||||||||| |||||||| || |||||||| |||||||  |||| |||||    
10283028 agagcaaggagatctctatagaagcagaagacaagttggttgactccaacattaagggcaactttggtgatgacatggtagccaccatataataactgca 10283127  T
129 cca 131  Q
    |||    
10283128 cca 10283130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 126
Target Start/End: Complemental strand, 10292590 - 10292502
Alignment:
38 agatctctgtagaggcaaaaaaccaactgattaaccccaacattaagggctactttggtaataacatggtaaccaccattgaatagctg 126  Q
    |||||||| |||| ||| || || || ||||| || |||  ||| ||||||||||| |||||||||| ||| ||||||||||| |||||    
10292590 agatctctatagaagcagaagactaattgattgactccagaattgagggctactttagtaataacatagtatccaccattgaaaagctg 10292502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 96 - 213
Target Start/End: Original strand, 41883551 - 41883668
Alignment:
96 taataacatggtaaccaccattgaatagctgcaccattgccatagccaaatgggctttccatgcgtcacttcccattgatgttgccattgaaattctagc 195  Q
    ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||  |||||||||||||| |||||||||||||||||||||    
41883551 taataacatggtaaccaccattgaataaccgcaccattgccatagccaaatgggctttccatctgtcacttcccattgctgttgccattgaaattctagc 41883650  T
196 ttgatttctgaaattcaa 213  Q
    || |||||||||||||||    
41883651 ttaatttctgaaattcaa 41883668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University