View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_high_28 (Length: 237)
Name: NF2858_high_28
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_high_28 |
 | |
|
| [»] scaffold1301 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold1301 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 1965 - 2128
Alignment:
| Q |
1 |
cgttttttgactgcattacggcattcaagttatcaccattaactgtttgtgaatgaacaggttcgaggatattttccaaaacacataaagtgtaataatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965 |
cgttttttgactgcattacggcattcaagttatcaccattaactgtttgtgaatgaacaggttcgaggatattttccaaaacacataaagtgtaataatg |
2064 |
T |
|
| Q |
101 |
ttttgactccctgaaaccataaaaatcatgttttggcataaccctgaatttctccttaacttgg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065 |
ttttgactccctgaaaccataaaaatcatgttttggcataaccctgaatttctccttaacttgg |
2128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1301; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 220
Target Start/End: Original strand, 1 - 38
Alignment:
| Q |
183 |
cttgcaagggctgatttaccaatccctgccataccgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1 |
cttgcaagggctgatttaccaatccctgccataccgac |
38 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 217
Target Start/End: Complemental strand, 18387759 - 18387708
Alignment:
| Q |
166 |
gatcattgcaaaggactcttgcaagggctgatttaccaatccctgccatacc |
217 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
18387759 |
gatcattgtaaaggaaatttgcaagggctgttttaccaatccctgccatacc |
18387708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 217
Target Start/End: Complemental strand, 17311568 - 17311498
Alignment:
| Q |
147 |
aatttctccttaacttggagatcattgcaaaggactcttgcaagggctgatttaccaatccctgccatacc |
217 |
Q |
| |
|
||||||||| |||||| | |||||||| |||| | | | |||||||||| ||||||||||||| ||||||| |
|
|
| T |
17311568 |
aatttctccataacttcgcgatcattgtaaagtagtttggcaagggctgttttaccaatccctcccatacc |
17311498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University