View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_low_12 (Length: 317)
Name: NF2858_low_12
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 301
Target Start/End: Complemental strand, 26441648 - 26441364
Alignment:
| Q |
18 |
ccctagtattgatttactatatttaatgtgtatctatgaacgagttatgcaaccataattttagatcaagaacttctcataatggaaacaataattgttt |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26441648 |
ccctagtattgctttactatatttaatgtgtatctatgaacgagttatgcaaccataagtttagatcaagaacttctcataatggaaacaataattgttt |
26441549 |
T |
 |
| Q |
118 |
cttagtagttgttgcaataataacaaacaattcctaaaatgaatata-ttttacaaaaatggtaacttgttctcaccttgttcatatggaattgaattat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26441548 |
cttagtagttgttgcaataataacaaacaattcctaaaatgaatatatttttacaaaaatggtaacttgttctcaccttgttcatatggaattgaattat |
26441449 |
T |
 |
| Q |
217 |
aatttgaaaatggatcataggagagctgctccgcattataatcattccagttaagcatttgtgcttgttgctcttgttgcatggt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26441448 |
aatttgaaaatggatcataggagagctgctccacattataatcattccagttaagcatttgtgcttgttgctcttgttgcatggt |
26441364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University