View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_low_22 (Length: 251)
Name: NF2858_low_22
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 45467345 - 45467121
Alignment:
| Q |
13 |
acttactactctatcatcagagtttaagaactttaatgcccaatgaaccatttattatagttctaccagtaaatgatagtatgctctggcatagaccatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45467345 |
acttactactctatcatcagagtttaagaactttaatgcccaatgaaccatttattat-gttctaccagtaaatgata---tgctctggcatagaccatt |
45467250 |
T |
 |
| Q |
113 |
tgaatcagtcttaaaccaatatgggctttgtaagttgttctataagcccaaagagtatcattctgcctaagagaccaaccttttcttgaattcgcgattg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45467249 |
tgaatcagtcttaaaccaatatgggctttgtaagttgttctataagcccaaagagtaccattctgcctaagagaccaaccttttcttgaattcgcgattg |
45467150 |
T |
 |
| Q |
213 |
tcatcttcaaaattctcttgatctctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45467149 |
tcatcttcaaaattctcttgatctctctg |
45467121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University